snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD113-10
sequence
TGGACTGTTGATGACAAGTGGTGGCTTATGTGGTTGTACATGCTGGTTGTATATGAAGA
ATATTACATATCTGAAACTTTGAGGTCCAA
  Box motif
  Complementary to target RNA
length 89
organism Homo_sapiens
snoRNA name SNORD113-10
alias
chromosome ⁄ contig 14
locus ⁄ host gene Poly:14:AL132709.5
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved