snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA63L8
sequence
GTGCATGTACTGTTACAATCTAACTGAAGTATTTTATTGTTACCCCTGCTTAAAGCAGT
ATAGATGCATAACTATGTCTGTTTAACTTCATTCCATAGTGAGACAGAGACACTTGGTTT
CAAACAT
  Box motif
  Complementary to target RNA
length 126
organism Homo_sapiens
snoRNA name SNORA63L8
alias
chromosome ⁄ contig 7
locus ⁄ host gene Mono:183:AC019117.4
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved