snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA1L1
sequence
AGCCTCTTTCTAGATGAGAATGGGCACTGTCGATCATGGTGTCTGAAAATTGTAAGTGG
CTAAATTGAAACACAGGTTATGCTTCCATAAGAGTATATGTATTGCAGTGGTGACAATGA
GACCTGTAACACTT
  Box motif
  Complementary to target RNA
length 133
organism Homo_sapiens
snoRNA name SNORA1L1
alias
chromosome ⁄ contig 16
locus ⁄ host gene Mono:147:AC004125.1
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved