snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus SNORD58
sequence
CAGCAGTGATGAGTATTTAGGACACCTTTGATTCTACATGAAGATTAAAGATGAAATCT
GAGCTGT
  Box motif
  Complementary to target RNA
length 66
organism Gasterosteus_aculeatus
snoRNA name SNORD58
alias
chromosome ⁄ contig scaffold_196
locus ⁄ host gene RPL17
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved