snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus SNORD59
sequence
TCTTCAGTGATGATTAACAAACTTTCGTTCTTCTGAGTTTACTGAAGCCAATATTTCTG
TCCTGAGAAGA
  Box motif
  Complementary to target RNA
length 70
organism Gasterosteus_aculeatus
snoRNA name SNORD59
alias
chromosome ⁄ contig scaffold_68
locus ⁄ host gene NACA2
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved