snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus SNORA63
sequence
AAGCAGGATAAGTTACAATGCAGTTAGTGGAGTACTGCTTTGTCGTTCCCCCTGCACAC
AATAACCTGTTTCCACGCTATACCTGTCAGTCAGCATCCCTAGACTGCCAGGCACGTACG
GTTTCAGACAA
  Box motif
  Complementary to target RNA
length 130
organism Gasterosteus_aculeatus
snoRNA name SNORA63
alias
chromosome ⁄ contig groupXVII
locus ⁄ host gene ENSGACG00000008496
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved