snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus SNORD35
sequence
TGCAAATGATTTCTTTCTCACGATGGTCTTCCAAGCCTTCAGGGTTCTGACGATAGTGC
CTTTTGGCAATGCTGATGCAGTCAT
  Box motif
  Complementary to target RNA
length 84
organism Gasterosteus_aculeatus
snoRNA name SNORD35
alias
chromosome ⁄ contig groupXI
locus ⁄ host gene RPS11
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved