snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus snoZ30
sequence
TGCAGTGATGAGCCTTAAGTGACTGATCTGGTATTGCTTTTTCCTTTCTTGGGGAGAGC
TCTGACCAGGGAATGATCTCGACTTAATCTTCTCTCTGAGC
  Box motif
  Complementary to target RNA
length 100
organism Gasterosteus_aculeatus
snoRNA name snoZ30
alias
chromosome ⁄ contig groupXI
locus ⁄ host gene KRI1
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved