snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus snoZ195
sequence
CCTGTCAGTGATGATTCCTTAACCCTGTTGTTCGAGTTTAAATGACAATGAGACTACCT
TACATGCACTACCATCTGAGACATG
  Box motif
  Complementary to target RNA
length 84
organism Gasterosteus_aculeatus
snoRNA name snoZ195
alias
chromosome ⁄ contig groupXV
locus ⁄ host gene RPL13A
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved