snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus SNORD83
sequence
GCCACATGATGAGCTCATAGATGCAGCAGCTCTCGGGCAGTGATGACCTGCTATCTATC
ACCCTTTTCTGATGGCT
  Box motif
  Complementary to target RNA
length 76
organism Gasterosteus_aculeatus
snoRNA name SNORD83
alias
chromosome ⁄ contig groupXV
locus ⁄ host gene DKC1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved