snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus SNORD60
sequence
AGCCAGTGATGACAAACAAACTTTTCTGACACCTCGTATGAGAGCTGCACTGCGGCTCC
TGATTCTAACGCTGATCTGAGGCTC
  Box motif
  Complementary to target RNA
length 84
organism Gasterosteus_aculeatus
snoRNA name SNORD60
alias
chromosome ⁄ contig groupIX
locus ⁄ host gene EIF3S9
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved