snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus SNORA5
sequence
TGCAGCCATGTCAAATTCAGTGTGTTCATTTCCGTGGACCTCACTGGCCAAAATGGCTG
CCACAGTGACTGTAGTTCATGGGCCCCACCTCCCTGCATGGTGGACTGTGGGGATAGATA
TGTACTACAAACAAAT
  Box motif
  Complementary to target RNA
length 135
organism Gasterosteus_aculeatus
snoRNA name SNORA5
alias
chromosome ⁄ contig groupXX
locus ⁄ host gene ATAD2
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved