snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus SNORD18
sequence
CATCAGTGATGAGCTTCCACTTCATGGTCTGTTTTTGCATCTGATACGTAAAGACGTTC
TGAGTCA
  Box motif
  Complementary to target RNA
length 66
organism Gasterosteus_aculeatus
snoRNA name SNORD18
alias
chromosome ⁄ contig groupXIX
locus ⁄ host gene Poly:4:SNORD18
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved