snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus SNORD49
sequence
TTCGGTGATGATAACCTAGGAAGTGCCGTCCGATGCGATAACTGACGATGGAATGAACT
GTTACCTGAGG
  Box motif
  Complementary to target RNA
length 70
organism Gasterosteus_aculeatus
snoRNA name SNORD49
alias
chromosome ⁄ contig scaffold_151
locus ⁄ host gene Poly:10:snoR38
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved