snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus snoR38
sequence
CAGCACACGTGATGATCTTGTTATCCCTGTCTGAAATAACGCGTGCTGACATAAATTAA
ATCTGATGCCTGCTG
  Box motif
  Complementary to target RNA
length 74
organism Gasterosteus_aculeatus
snoRNA name snoR38
alias
chromosome ⁄ contig scaffold_151
locus ⁄ host gene Poly:10:snoR38
organization Poly
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved