snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus SNORA8
sequence
AGCACTGTGTGGTATCTGCAGCCAGTTGGTTCCTCAGCTGGTTTGTTCAAAAGTCAGTG
CTAGAACAACTCAGCGTCTGGCATCGTTGGTCTCCATGCTGCCGGTGTGTGGAGTCCTGG
TATGGTTGTTGAGACACTA
  Box motif
  Complementary to target RNA
length 138
organism Gasterosteus_aculeatus
snoRNA name SNORA8
alias
chromosome ⁄ contig scaffold_101
locus ⁄ host gene Poly:9:SNORA18
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved