snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus snosnR60_Z15
sequence
CTGATACAATGATGAGCGCATAGTTCAACAGATTAACAATGACGATCATGCGTTTTTGT
CTTTCGCTCCTATCTGATGTGTTGG
  Box motif
  Complementary to target RNA
length 84
organism Gasterosteus_aculeatus
snoRNA name snosnR60_Z15
alias
chromosome ⁄ contig groupVIII
locus ⁄ host gene Poly:7:SNORD75
organization Poly
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved