snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus SNORD75
sequence
AGTCTGTGATGCATTTAGAGTAGTGGACAGATGTGATTTCTGACAAATTCAACTCTGAG
ACT
  Box motif
  Complementary to target RNA
length 62
organism Gasterosteus_aculeatus
snoRNA name SNORD75
alias
chromosome ⁄ contig groupVIII
locus ⁄ host gene Poly:7:SNORD75
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved