snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus SNORD65
sequence
TCGTGATGAAATTCAAACAAACAGCTGGAATTACCGGCAGATTGTTTAGTGGTGACGCT
TTGTTTTCTGAAC
  Box motif
  Complementary to target RNA
length 72
organism Gasterosteus_aculeatus
snoRNA name SNORD65
alias
chromosome ⁄ contig groupVII
locus ⁄ host gene Poly:3:SNORD65
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved