snOPY snoRNA Orthological Gene Database
Gallus_gallus SNORD72
sequence
AGCTTGTCAATGATGTTTCTTACTAAAATGTCTGAACATATGAACTTCATAGTGATTTC
AGTGCATTACTGAGATAAGCT
  Box motif
  Complementary to target RNA
length 80
organism Gallus_gallus
snoRNA name SNORD72
alias
chromosome ⁄ contig Z
locus ⁄ host gene RPL37
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved