snOPY snoRNA Orthological Gene Database
Gallus_gallus SNORA66
sequence
TTGCAAACTCGATCACTAGCTCTGCATGATGTTGCAGAAGCAAGGGGAACAGGTTTGCT
AAAGTAAACATGGTAATAGAACCATATTAGCCTTAGAAATCAAATGATTGGGGCTGTTAA
TTCTATACCATGATAAGG
  Box motif
  Complementary to target RNA
length 137
organism Gallus_gallus
snoRNA name SNORA66
alias
chromosome ⁄ contig Z
locus ⁄ host gene ENSGALG00000003235
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved