snOPY snoRNA Orthological Gene Database
Gallus_gallus SNORD59
sequence
CCTTCGCTGATGAGTAACCTTTTGACTTTCGTTCTACTGAGCTTGCTGAAGCAACGTTC
ATTACCTGAGGAGG
  Box motif
  Complementary to target RNA
length 73
organism Gallus_gallus
snoRNA name SNORD59
alias
chromosome ⁄ contig E22C19W28_E50C23
locus ⁄ host gene ATP5B
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved