snOPY snoRNA Orthological Gene Database
Gallus_gallus SNORA63
sequence
AAGCAGGATAAGTTATGATATAGCTGTGCAGTGCTGTATTATCGTTCCCCCTGCTTAAA
GAAAAATGTTTCCTTCTATCCCTACCTGCTTAGTTCCCACAGCAGGTAGGGACGCTGGGT
TTCATACAT
  Box motif
  Complementary to target RNA
length 128
organism Gallus_gallus
snoRNA name SNORA63
alias
chromosome ⁄ contig 9
locus ⁄ host gene IF4A2_CHICK
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved