snOPY snoRNA Orthological Gene Database
Gallus_gallus SNORA75
sequence
CACTTCTCAATGAGCTCCTTCCTGCCGACATATCCGTGGCAGCCTATGGATTCGCATGA
GAAGGACATAAACAGCTCAGTAGTGGCACACTCACAACCTGGTTATACATCAGTTGTGAT
TAACCACTTACTGTTCTACAAGT
  Box motif
  Complementary to target RNA
length 142
organism Gallus_gallus
snoRNA name SNORA75
alias
chromosome ⁄ contig 9
locus ⁄ host gene NUCL_CHICK
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved