snOPY snoRNA Orthological Gene Database
Gallus_gallus SNORA69
sequence
ATAGCAGGCTGCAATTGCAGTGCTTCATTCTGTGGGAGTACTGCCATTTTCCTGCTGAG
AGTAATTCTGTTAATGCTGTGTTTGGTTTTACCTATATGTTGGTGAAACTGTTTGTCCTT
AACATGAACATCA
  Box motif
  Complementary to target RNA
length 132
organism Gallus_gallus
snoRNA name SNORA69
alias
chromosome ⁄ contig 4
locus ⁄ host gene RL39_CHICK
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved