snOPY snoRNA Orthological Gene Database
Gallus_gallus SNORA53
sequence
CACATGCTCCTTAGATCCATCTTTGTGAGTATCTTTGTGCTGAGTTCTGCTGGATAACT
TCAGTTTCTAGCAGTTCCAGTCAAAGTTGCTCGGCAACTTTTTTGGTTGTACGGTCAAAG
ATGCTTGAGTCATTGGCATGTGAGAGTAATATAACTGCATGTTAGCTTTCTGTTCTGATA
AAAGTGACTGTAAATATGAGAGTCATTTACCGCTATCAGGACATGGCTGGTATGCAGACA
TT
  Box motif
  Complementary to target RNA
length 241
organism Gallus_gallus
snoRNA name SNORA53
alias
chromosome ⁄ contig 1
locus ⁄ host gene NP_001006236.1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved