snOPY snoRNA Orthological Gene Database
Gallus_gallus SNORA72
sequence
ATGCGAATATTCTCGCTGCCCTGATATTCCGGTGATCAGGGGAGGCTAGACATTCGCTA
TATTAAAACTATGCATTGTGTCCTCCAGGACTGGACTGCTGCTCTAGTACTGGCTTTGAA
AATGCTAGTGACATAC
  Box motif
  Complementary to target RNA
length 135
organism Gallus_gallus
snoRNA name SNORA72
alias
chromosome ⁄ contig Un_random
locus ⁄ host gene Mono:10:SNORA72
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved