snOPY snoRNA Orthological Gene Database
Gallus_gallus SNORD50
sequence
CATCTATGATGATCCTATCCCGAACCTGAATTCTTTGCTGAAAAACCTACTACGGATCC
GGCATCTGAGAT
  Box motif
  Complementary to target RNA
length 71
organism Gallus_gallus
snoRNA name SNORD50
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:7:SNORD50
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved