snOPY snoRNA Orthological Gene Database
Felis_catus SNORD37
sequence
GTCAATGATGACTGATATTTCTTCACTTTGACCTGATGGCTATTGAAGAAATCTGATGT
CTGAGG
  Box motif
  Complementary to target RNA
length 65
organism Felis_catus
snoRNA name SNORD37
alias
chromosome ⁄ contig GeneScaffold_3173
locus ⁄ host gene EEF2
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved