snOPY snoRNA Orthological Gene Database
Felis_catus SNORD95
sequence
GGGGCGGTGATGACCCCAACATGCCATCTGAGTGCCCATGCTGAGACCCAGAGGCTGTT
TCTGAGCTG
  Box motif
  Complementary to target RNA
length 68
organism Felis_catus
snoRNA name SNORD95
alias
chromosome ⁄ contig GeneScaffold_2327
locus ⁄ host gene GNB2L1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved