snOPY snoRNA Orthological Gene Database
Felis_catus SNORD71
sequence
GGTGTGCTGGAGGATGAAAATACGGAGTGATCCATCGGCTAAGTGATTTATCACAATGC
TGAAACTCATATTGCTGACAGCACACA
  Box motif
  Complementary to target RNA
length 86
organism Felis_catus
snoRNA name SNORD71
alias
chromosome ⁄ contig GeneScaffold_2106
locus ⁄ host gene AP1G1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved