snOPY snoRNA Orthological Gene Database
Felis_catus SNORD58
sequence
CTGCAGTGATGCGTTTCTTAGGACACCTTTGGATTTACCATGAAAACTAATCAGTTCTG
AGCAGT
  Box motif
  Complementary to target RNA
length 65
organism Felis_catus
snoRNA name SNORD58
alias
chromosome ⁄ contig GeneScaffold_2144
locus ⁄ host gene DYM
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved