snOPY snoRNA Orthological Gene Database
Felis_catus SNORD39
sequence
TGTGGATGATGACACCTTGATAATGCTGTAAACTCCCGAGTGCGCAGTGGGGGAACCAA
CCTTGGAGAGCTGAGCGTGCG
  Box motif
  Complementary to target RNA
length 80
organism Felis_catus
snoRNA name SNORD39
alias
chromosome ⁄ contig GeneScaffold_2167
locus ⁄ host gene RPS8
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved