snOPY snoRNA Orthological Gene Database
Felis_catus SNORD17
sequence
GTGAAGTGATGATTCAGTTTATCCATTCGCTGAGTGCGCTGCACTGACCTTCTTCCAAG
CCTCGGTTCCTGTTCTAGGAACTCGGAGCTATGTAGCCTCTAAATGCCCTGCAGTCTGCA
GTGTTCTACTGTGGACAGCTTGTGTGTTGGTAGACTACCGGTAAGAATGGTTGGTGTCAG
CAGGGGTGGGGCCCTCTGGGTCCCATCTCACCAAGATGAGTGGTGGAAATCTGATCAC
  Box motif
  Complementary to target RNA
length 237
organism Felis_catus
snoRNA name SNORD17
alias
chromosome ⁄ contig GeneScaffold_511
locus ⁄ host gene SNX5
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved