snOPY snoRNA Orthological Gene Database
Felis_catus SNORA29
sequence
ACTCCCATTTGACTACCACATTTTCTCCCAATAATAGATTTTGGTGGCTATGCTTATGG
GATAGATTAAAATTGCCATGATCTGAAGAGGGAGGATTTATTTGTGTCCTCCTTCTATAT
GAAATGGCTGAACAGAAAATT
  Box motif
  Complementary to target RNA
length 140
organism Felis_catus
snoRNA name SNORA29
alias
chromosome ⁄ contig GeneScaffold_3261
locus ⁄ host gene BUB1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved