snOPY snoRNA Orthological Gene Database
Felis_catus SNORA46
sequence
TGCACTATTCTTTAAACCTGTGGATGGGAATTTTCCCCATTCTTGGTTACGCTGTAGTG
CAAAAGAATTCCTGGCTCTTTCTCTTGCACAGCTGACCTGCCATTCTGCTGTTGCTATGT
AGAGTTAAGGAACATAA
  Box motif
  Complementary to target RNA
length 136
organism Felis_catus
snoRNA name SNORA46
alias
chromosome ⁄ contig GeneScaffold_3078
locus ⁄ host gene MED17
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved