snOPY snoRNA Orthological Gene Database
Felis_catus SCARNA9
sequence
TCTCTGAGATCTACTCTTCCTGAAGTGGATCAATGATGAAAATAGCCAAATCTGAGCAT
CAGAAGACTTTGCAGTCTATCTGATGCATGATCTCTGTAGTTCTGAGAAGCAAAAGTAAT
TTTAAACAGTAAGGGCCTATGTCTGGCATGTGTGTGTGTGTGTGTGTGCGTGTGTGTGTG
TGTGTGTGTGTGTAAAGGTGATAGTATATAACCAAGAACTTGATGAATGAGATAGGGATG
GGGTGGAGGAGATACGTGTGTGTATGGAAGTCTAATCAGTTCTGAGCAATGATGAAAAGG
TTTTAGTACTGACCTTTACAGCTATGAAGGTTTCTACACTTGATCTGAGCTCA
  Box motif
  Complementary to target RNA
length 352
organism Felis_catus
snoRNA name SCARNA9
alias
chromosome ⁄ contig GeneScaffold_3078
locus ⁄ host gene KIAA1731
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved