snOPY snoRNA Orthological Gene Database
Felis_catus snoMBII-202
sequence
TGATGACATTCTCCGGAATCGCTGCACCTCTTTGATGAGAGCGCTTTTGAACCCTTTTC
CATCTGACGGCCGGGCACC
  Box motif
  Complementary to target RNA
length 78
organism Felis_catus
snoRNA name snoMBII-202
alias
chromosome ⁄ contig GeneScaffold_4190
locus ⁄ host gene RPL13
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved