snOPY snoRNA Orthological Gene Database
Felis_catus SNORA9
sequence
TTGCAAACCTTCCAGCATGCTGGGGTCTAGGGTAACTCAGTGTATTCCTCCAGTGCTTG
CTAGAACGTTCTGAAATGTTTTGAGACTTTGCCCTGTCCCTTCCGCAGAGCGTGGTCATA
GACATTTCAGACAGTT
  Box motif
  Complementary to target RNA
length 135
organism Felis_catus
snoRNA name SNORA9
alias
chromosome ⁄ contig GeneScaffold_3834
locus ⁄ host gene ZCCHC8
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved