snOPY snoRNA Orthological Gene Database
Felis_catus SNORD61
sequence
GCTGTGATGAATTTGATTACGTTGATCGTCTGACGTGATACATTTTGTCCTCTAAGAAG
TTCTGAGCTT
  Box motif
  Complementary to target RNA
length 69
organism Felis_catus
snoRNA name SNORD61
alias
chromosome ⁄ contig scaffold_204876
locus ⁄ host gene ENSFCAG00000004779
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved