snOPY snoRNA Orthological Gene Database
Felis_catus SNORD36
sequence
TTGCCGATGATGGTTACGAATTTCTTCACCTGAATAAGCCGTGTGGTCGTGTTGTGTCT
GAGGCAAA
  Box motif
  Complementary to target RNA
length 67
organism Felis_catus
snoRNA name SNORD36
alias
chromosome ⁄ contig scaffold_201764
locus ⁄ host gene RPL7A
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved