snOPY snoRNA Orthological Gene Database
Felis_catus snoU83B
sequence
GCTGTTCAGTGATGAGGCTCTGGAATGAGCGCTGGGCACAGCGCCCGAGTCCAACTGCG
GAAACGTTCCTTGCTGCCTTCCTTCTGAGAACAGC
  Box motif
  Complementary to target RNA
length 94
organism Felis_catus
snoRNA name snoU83B
alias
chromosome ⁄ contig scaffold_166251
locus ⁄ host gene RPL3
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved