snOPY snoRNA Orthological Gene Database
Felis_catus SNORD51
sequence
ACTTAAAAATGATGAGTAAAACCAAATCACCATCTTTCGGCTGAGCTCGTGATGGATTT
GCTTTTTTCTGATGAGACT
  Box motif
  Complementary to target RNA
length 78
organism Felis_catus
snoRNA name SNORD51
alias
chromosome ⁄ contig scaffold_162460
locus ⁄ host gene EEF1B2
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved