snOPY snoRNA Orthological Gene Database
Felis_catus SNORA54
sequence
AGGCACTGTTCGTGGCCTGTCAGTCTGGCTGTGGCTTACGGGCTCCATTCCAGTGCGAC
AGCATTTCCAACGGCACGTGACTGACTGACTCGTGGCTCTCAGTTTCAGGTCCTGGGGAC
ACAA
  Box motif
  Complementary to target RNA
length 123
organism Felis_catus
snoRNA name SNORA54
alias
chromosome ⁄ contig scaffold_213946
locus ⁄ host gene SNORD23
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved