snOPY snoRNA Orthological Gene Database
Felis_catus SNORD64
sequence
GGATTTATGATGAGTTATGTTTACTGAGTATGATGAAGTGAAACTCAGTGTGAGTACTC
TGAAGTCC
  Box motif
  Complementary to target RNA
length 67
organism Felis_catus
snoRNA name SNORD64
alias
chromosome ⁄ contig scaffold_2980
locus ⁄ host gene Mono:16:SNORD64
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved