snOPY snoRNA Orthological Gene Database
Felis_catus SNORA9
sequence
CGGCAAGCCTCCAGCGTGCCTGGGTCTGGGGTGGCCCCGTGCATTCCTTTAGTGCTTGC
AAGAACATTGGGAAACGGTTTGAGGCCTTGCCCTGCTCCATCCAGAGCAAGGTTATAGAC
ATTTCGAACAGAT
  Box motif
  Complementary to target RNA
length 132
organism Felis_catus
snoRNA name SNORA9
alias
chromosome ⁄ contig GeneScaffold_93
locus ⁄ host gene Mono:120:SNORA9
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved