snOPY snoRNA Orthological Gene Database
Felis_catus SNORA70
sequence
ATGCACAACTGGCTGAAGACTAGAAGGATACCCAGGGTGCAACGGCTGCAAATAGTAAC
CTCTTTGGTAGTGTATGCAGCCTGTTGATTGTATGGGACCTTGGAGACAGGC
  Box motif
  Complementary to target RNA
length 111
organism Felis_catus
snoRNA name SNORA70
alias
chromosome ⁄ contig scaffold_197266
locus ⁄ host gene Mono:52:SNORA70
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved