snOPY snoRNA Orthological Gene Database
Felis_catus SNORD29
sequence
ATTCTATGATAAATAAAACTAGCTCACTATGACTTACAAAATGAAAGAATGTGAAAATG
AAGA
  Box motif
  Complementary to target RNA
length 63
organism Felis_catus
snoRNA name SNORD29
alias
chromosome ⁄ contig scaffold_101240
locus ⁄ host gene Mono:69:SNORD29
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved