snOPY snoRNA Orthological Gene Database
Felis_catus SNORA46
sequence
CACTATATATCTAAACCTGTCAATGGGAATTGTCCCCTTTCTTGGTCCCACTCTTGTGT
GAAAGAATTCCTGGCTCTTTCTGTCGCACAGCTGACTTCGTGCCATTCTGCTGTTGCTGT
ATAGAGTTAGGGAACATAC
  Box motif
  Complementary to target RNA
length 138
organism Felis_catus
snoRNA name SNORA46
alias
chromosome ⁄ contig scaffold_192697
locus ⁄ host gene Mono:49:SNORA46
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved