snOPY snoRNA Orthological Gene Database
Felis_catus SNORD79
sequence
TTAGTGATGATTTTTGAAATTAAAAACAGATGGGAATCTCTCTGAAAAAGAGTGAAGAT
TTCTTAAACGCTGAAA
  Box motif
  Complementary to target RNA
length 75
organism Felis_catus
snoRNA name SNORD79
alias
chromosome ⁄ contig scaffold_128053
locus ⁄ host gene Poly:0:snosnR60_Z15
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved